A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: UM0021Publication date: 04/03
PMID: N/AGI: 30523247 Taxonomy ID: 227984
Virus Name: SARS coronavirusProduct size (PCR): 310 bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):N/A
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: From WHO website URL:
http://www.who.int/csr/sars/primers/en/
Primer information provided by:
Government Virus Unit
9/F Public Health Laboratory Centre
382 NAm Cheong Street
Shek Kip Mei
Kowloon, Hong Kong SAR
Hong Kong - SAR China
Forward(COR-1) primer
Oligo type: PCRDegeneracy: 1
Target: 15318-15343Tm: 77.3 C at salt 1000.0mMLength:
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note: Target range from sequence.
Reverse(COR-2) primer
Oligo type:
Degeneracy: 1
Target: 15628-15603Tm: 72.6 C at salt 1000.0mMLength:
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note: Target range from sequence.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.