A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: UM0020Publication date: 8/2003
PMID: 12690091GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS CoronavirusProduct size (PCR): 77 bp
MgCl2: N/A mMdNTPs: mMType: Real-time PCR
Temp (PCR cycle):45C 15min>95C 3min>(95C 10sec>58C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq polymerase one-step RT-PCR kit (Invitrogen).
Polymerase: Platinum Taq polCycler: N/A
Note: Reaction of 25 µl total volume consisted of 12.5microL 2X reaction buffer, 3.6mM magnesium sulfate, 1microg bovine serum albumin, 240 nM probe, 200 nM each primer, 0.6 microL reverse-transcriptase/Taq DNA polymerase mixture and 5 µl RNA.

5'-nuclease method used with fluorescence measured at 58C.

For additional PCRs from this article, [see UM0015], [see UM0016], [see UM0017], [see UM0018], [see UM0019].
Forward(BNITMSARS1) primer
Oligo type: PCRDegeneracy: 1
Target: 18187-18206Tm: 72 C at salt 1000.0mMLength:
Sequence: TTATCACCCGCGAAGAAGCT
(2 other experimental conditions)
Note: Target range from sequence.
Reverse(BNITMSARAs2) primer
Oligo type: PCRDegeneracy: 1
Target: 18264-18243Tm: 76.6 C at salt 1000.0mMLength:
Sequence: CTCTAGTTGCATGACAGCCCTC
(2 other experimental conditions)
Note: Target range from sequence.
Forward(BNITMSARP) primer
Oligo type:
Degeneracy: 1
Target: 18218-18241Tm: 77 C at salt 1000.0mMLength:
Sequence: TCGTGCGTGGATTGGCTTTGATGT
(2 other experimental conditions)
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.