A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: UM0019Publication date: 8/2003
PMID: 12690091GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS CoronavirusProduct size (PCR): 108 bp
MgCl2: 2.5 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):95C 3min>(95C 10sec>60C 10sec[-1C/cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*20
Buffer: InVitrogen
Polymerase: 0.025 units/microL platinum Taq pol (InVitrogen)Cycler:
Note: Reaction of 50microL total volume consisted, in addition, of 5microL 10X reaction buffer (InVitrogen), 200 nM each primer and1microL PCR product from previous round.

For first round PCR [see UM0017]. For additional PCRs from this article, [see UM0015], [see UM0016], [see UM0018], [see UM0020].
Forward(BNlinS) primer
Oligo type: PCRDegeneracy: 1
Target: 18201-18220Tm: 72 C at salt 1000.0mMLength:
Sequence: GAAGCTATTCGTCACGTTCG
(7 other experimental conditions)
Note: Target range from sequence.
Reverse(BNIinAs) primer
Oligo type: PCRDegeneracy: 1
Target: 18309-18288Tm: 72.9 C at salt 1000.0mMLength:
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.