A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: UM0017Publication date: 8/2003
PMID: 12690091GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS CoronavirusProduct size (PCR): 189 bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Reactions were conducted in 20microL total volume containing: 10microL 2X reaction buffer, 2.45mM magnesium sulfate, 500nM each primer, 0.4microL reverse-transcriptase/Taq DNA polymerase mixture and 2microL RNA.

For a nested PCR using this one for first round amplification, [see UM0019]. For additional PCRs from this article, [see UM0015], [see UM0016], [see UM0018], [see UM0020].
Forward(BNIoutS2) primer
Oligo type: PCRDegeneracy: 1
Target: 18153-18176Tm: 70.2 C at salt 1000.0mMLength:
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.
Reverse(BNIouutAs) primer
Oligo type: PCRDegeneracy: 1
Target: 18342-18322Tm: 72.5 C at salt 1000.0mMLength:
Sequence: CATAACCAGTCGGTACAGCTA
(1 other experimental conditions)
Note: Target range from sequence.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.