A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: UM0012Publication date: 04/03
PMID: 12690092GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):N/A
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Article did not specify whether primers used for two separate PCRs or for a semi-nested PCR

Access RT-PCR (Promega) system used. Conditions in Falsey et al. [PMID:12599052]

For additional T-PCR from this article [see UM0013]
Forward(Cor-p-F2 (+)) primer
Oligo type: PCRDegeneracy: 1
Target: 15250-15270Tm: 68.5 C at salt 1000.0mMLength:
Sequence: CTAACATGCTTAGGATAATGG
(4 other experimental conditions)
Note:
Forward(Cor-p-F3 (+)) primer
Oligo type: PCRDegeneracy: 1
Target: 15270-15290Tm: 76.4 C at salt 1000.0mMLength:
Sequence: GCCTCTCTTGTTCTTGCTCGC
(2 other experimental conditions)
Note: Target from sequence
Reverse(Cor-p-R1 (–)) primer
Oligo type:
Degeneracy: 1
Target: 15597-15617Tm: 70.5 C at salt 1000.0mMLength:
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.