A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: TA0061Publication date: 11/03
PMID: 14633916GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Real-time RT-PCR
Temp (PCR cycle):95C 5min>(94C 20sec>56C 1min)*40
Buffer:
Polymerase: Cycler:
Note: The RT-PCR reaction is performed by EZ rTth RNA PCR reagent set (Applied Biosystems). Fluorescent probes were used at concentration of 100nM.
Forward(SARSPol1 forward) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15342-15364Tm: 73.2C at salt 1000.0 mMLength:
Sequence: GAGTGTGCGCAAGTATTAAGTGA
(2 other experimental conditions)
Note:
Reverse(SARSPol1 reverse) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15413-15392Tm: 71C at salt 1000.0 mMLength:
Sequence: TGATGTTCCACCTGGTTTAACA
(2 other experimental conditions)
Note:
Forward(SARSPol1 probe) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 15366-15389Tm: 78.7C at salt 1000.0 mMLength:
Sequence: ATGGTCATGTGTGGCGGCTCACTA
(2 other experimental conditions)
Note: FAM is on 5' end and TAMRA is on 3' end.
Forward(SARSN forward) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28773-28788Tm: 52CLength:
Sequence: TGCCCTCGCGCTATTG
(2 other experimental conditions)
Note:
Reverse(SARSN reverse) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 28837-28817Tm: 72.5C at salt 1000.0 mMLength:
Sequence: GGCCTTTACCAGAAACTTTGC
(2 other experimental conditions)
Note:
Forward(SARSN probe) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 28790-28813Tm: 75.3C at salt 1000.0 mMLength:
Sequence: TGCTAGACAGATTGAACCAGCTTG
(2 other experimental conditions)
Note: FAM is on 5' end and TAMRA is on 3' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.