A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: TA0055Publication date: 09/04
PMID: 15349945GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 240, 438 bp
MgCl2: 2.5 mMdNTPs: mMType: Multiplex RT-PCR
Temp (PCR cycle):94C 5min>(94C 0.5min>55C 0.5min>72C 0.5min)*30>72C 7min
Buffer: 1XPCR buffer II
Polymerase: LA Taq DNA polyCycler: GeneAmp PCR system 2400 (Perkin-Elmer)
Note:
Forward(TA005501) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 17743-17762Tm: 72C at salt 1000.0 mMLength:
Sequence: TAGGATTGCCTACGCAGACT
(1 other experimental conditions)
Note:
Forward(TA005502) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15240-15259Tm: 72C at salt 1000.0 mMLength:
Sequence: AGAGCCATGCCTAACATGCT
(1 other experimental conditions)
Note:
Reverse(TA005503) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15479-15460Tm: 70C at salt 1000.0 mMLength:
Sequence: ATTGGCTGTAACAGCTTGAC
(1 other experimental conditions)
Note:
Reverse(TA005504) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18180-18161Tm: 70C at salt 1000.0 mMLength:
Sequence: TAGGGTAACCATTGACTTGG
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.