A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: TA0050Publication date: 05/04
PMID: 15200815GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 5min>(94C 45sec>60C 45sec>72C 45sec)*45>72C 7min
Buffer: 1.2mM Magnesium sulphate
Polymerase: Platinum Taq (Invitrogen)Cycler:
Note: RT-PCR was performed in a single tube system called Superscript One-Step RT-PCR (Invitrogen).
Forward(COR-1) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15318-15343Tm: 77.3C at salt 1000.0 mMLength:
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:
Reverse(COR-2) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15628-15603Tm: 72.6C at salt 1000.0 mMLength:
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.