A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0088Publication date: 11/00
PMID: 11044116GI: 4099928 Taxonomy ID: 11246
Virus Name: Bovine respiratory syncytial virus, BRSVProduct size (PCR):
bp
MgCl2: 1.0 mMdNTPs: mMType: RT-Nested PCR 2
RT-Nested PCR 1 RT-nested PCR 2 RT-Nested PCR 1 RT-nested PCR 2
Temp (PCR cycle):94C 12min>(94C 45sec>58C 60sec>72C 60sec)*35>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL AmpliTaq Gold poly (Perki-Elmer)Cycler: GeneAmp PCR system 480 (Perkin-Elmer)
Note: For RT and primary PCR, [see SW0087].

Total PCR volume is 100microL containing 10microL primary PCR product (1:10) and 0.5microM each primer.
Article cites 200mM each dNTP being used in PCR.

For other PCRs in this article, [see SW0085], [see SW0086], and [see SW0089].
Forward(VG1) primer
Oligo type: PCRDegeneracy: 1
Target: 131-155Tm: 77.2 C at salt 1000.0mMLength:
Sequence: CCACCCTAGCAATGATAACCTTGAC
(2 other experimental conditions)
Note:
Reverse(VG4) primer
Oligo type: PCRDegeneracy: 1
Target: 672-648Tm: 77.2 C at salt 1000.0mMLength:
Sequence: GCTAGTTCTGTGGTGGATTGTTGTC
(3 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.