A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0087Publication date: 11/00
PMID: 11044116GI: 17939982 Taxonomy ID: 11246
Virus Name: Bovine respiratory syncytial virus, BRSVProduct size (PCR):
bp
MgCl2: 1.0 mMdNTPs: mMType: RT-Nested PCR 1
RT-nested PCR 2
Temp (PCR cycle):94C 12min>(94C 60sec>55C 60sec>72C 90sec)*35>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL AmpliTaq Gold poly (Perkin-Elmer)Cycler: GeneAmp PCR system 480 (Perkin-Elmer)
Note: 10microL containing RNA and 0.2microM primer G2.5 are incubated 68C 10min>58C 10min and then chilled on ice.
Total RT volume is 25microL containing 400M each dNTP, 1.6U/microL RNasin (Promega), 8.0mM DTT (Gibco BRL), 4microL SuperScript TM II buffer (Gibco BRL), and 8.0U/microL SuperScript TM II (Gibco BRL).
RT temperature: 42C 50min>70C 15min.
Article cites 10mmol dNTPs being used in 25microL.

Total PCR volume is 100microL containing 10microL diluted cDNA (1:10) and 0.5microM each primer.
Article cites 200mM each dNTP being used in PCR.

For secondary PCR, [see SW0088].
For other PCRs in this article, [see SW0085], [see SW0086], and [see SW0089].
Forward(G2.5) primer
Oligo type: PCRDegeneracy: 1
Target: 4736-4756Tm: 70.5 C at salt 1000.0mMLength:
Sequence: AGACATTAAAGAGGGCTTGGA
(0 other experimental conditions)
Note: Position given in article is 11-31.
Reverse(F2.7) primer
Oligo type: PCRDegeneracy: 1
Target: 5687-5668Tm: 70 C at salt 1000.0mMLength:
Sequence: CTGCACTGCATGTTGATTGA
(0 other experimental conditions)
Note: Position given in article is 118-99.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.