A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0081Publication date: 06/99
PMID: 10325337GI: 450251 Taxonomy ID: 11246
Virus Name: Bovine respiratory syncytial virus, BRSVProduct size (PCR):
bp
MgCl2: 1.0 mMdNTPs: mMType: RT-Nested PCR
Temp (PCR cycle):94C 12min>(94C 60sec>58C 60sec>72C 90sec)*35>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL AmpliTaq Gold poly (Perkin Elmer Cetus)Cycler: GeneAmp PCR System 480 (Perkin Elmer Cetus)
Note: 10microL containing RNA and 0.2microM primer N2.1 are incubated 68C 10min>58C 10min and then chilled on ice.
Total RT volume is 25microL containing 10microL RNA-primer mixture, 400M each dNTP, 1.6U/microL RNasin (Promega), 8.0mM DTT (Gibco BRL), 4microL SuperScript TM II buffer, and 8.0U/microL SuperScript TM II (Gibco BRL).
RT temperature: 42C 50min>70C 15min.

Total primary PCR volume is 100microL containing 10microL diluted cDNA (1:10) and 0.5mM each primers N2.1 and N2.2 (1034bp-product).

Total secondary PCR volume is 100microL containing 10microL diluted primary PCR product (1:10) and 0.5mM each primers N2.3 and N2.4 (731bp-product). The secondary PCR conditions are identical to the primary PCR's except the cycle is 94C 12min>(94C 45sec>49C 60sec>72C 60sec)*35>72C 10min.
Forward(N2.1) primer
Oligo type: PCRDegeneracy: 1
Target: 1-19Tm: 71.5 C at salt 1000.0mMLength:
Sequence: ATGGCTCTCAGCAAGGTCA
(1 other experimental conditions)
Note: Used with N2.2 for primary PCR.
Reverse(N2.2) primer
Oligo type: PCRDegeneracy: 1
Target: 1034-1013Tm: 72.9 C at salt 1000.0mMLength:
Sequence: TCTTGGTTTCTTGGTGTACCTC
(1 other experimental conditions)
Note: Used with N2.1 for primary PCR.
Forward(N2.3) primer
Oligo type: PCRDegeneracy: 1
Target: 127-146Tm: 67.9 C at salt 1000.0mMLength:
Sequence: CATCTCAATAAGTTGTGTGG
(1 other experimental conditions)
Note: Used with N2.4 for secondary PCR.
Reverse(N2.4) primer
Oligo type: PCRDegeneracy: 1
Target: 857-838Tm: 67.9 C at salt 1000.0mMLength:
Sequence: TCTACAACCTGTTCCATTTC
(1 other experimental conditions)
Note: Used with N2.3 for secondary PCR.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.