A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0055Publication date: 02/97
PMID: 9066027GI: 330754 Taxonomy ID: 10323
Virus Name: Bovine herpesvirus type 1.1 (strain Cooper)Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):(94C 1min>65C 1min>72C 2min[+3.5sec/cyc])*40>72C 7min
Buffer: PCR buffer
Polymerase: 0.05U/microL Taq polyCycler:
Note: Total PCR volume is 100microL containing 20ng/microL and 1.5microM each primer.
Article does not mention amount or reagents of buffer.

PCR products are blotted onto filters. Prehybridization is performed in 5x SSPE, 0.5% BSA, 0.5% polyvinylpyrrolidone, and 1% SDS at 65C 30min. Hybridization is performed in the same buffer with probe at 65C 1hr.
Forward(SW00550) primer
Oligo type: PCRDegeneracy: 1
Target: 546-566Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAGCAAAGCCCCGCCGAAGGA
(0 other experimental conditions)
Note: Specific to BHV-1 gC gene.
Reverse(SW00551) primer
Oligo type: PCRDegeneracy: 1
Target: 774-754Tm: 80.3 C at salt 1000.0mMLength:
Sequence: TACGAACAGCAGCACGGGCGG
(1 other experimental conditions)
Note: Specific to BHV-1 gC gene.
Reverse(SW00552) primer
Oligo type: HybridizationDegeneracy: 1
Target: 702-681Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAACCTGCCCACGCGCTGAAAC
(1 other experimental conditions)
Note: Specific to BHV-1 gC gene.
Forward(SW00553) primer
Oligo type: PCRDegeneracy: 1
Target: 996-1016Tm: 80.3 C at salt 1000.0mMLength:
Sequence: TTTCGCCCTGCTCTGCCTGCC
(1 other experimental conditions)
Note: Forward primer for BGH gene. GI: 163091
Reverse(SW00554) primer
Oligo type:
Degeneracy: 1
Target: 1177-1157Tm: 84.2 C at salt 1000.0mMLength:
Sequence: CCCTTCCTGCCTCCCCACCCC
(0 other experimental conditions)
Note: Reverse primer for BGH gene. GI: 163091
Forward(SW00555) primer
Oligo type: PCR Probe (eg. fluorescent probe, etc)Degeneracy: 1
Target:
-
Tm: 80.6 C at salt 1000.0mMLength:
Sequence: GACACCTTCAAAGAGTTTGTAAGCTCCCGA
(1 other experimental conditions)
Note: Probe for BGH gene. Target start and end unavailable according to BLAST.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.