A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0051Publication date: 07/98
PMID: 9713819GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1, BVDVProduct size (PCR):
bp
MgCl2: 1.0 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 2min>(95C 1min>55C 1min>72C 1min)*50>72C 7min
Buffer: 1x PCR buffer (Perkin Elmer)
Polymerase: 0.025U/microL AmpliTaq Gold DNA poly (Perkin Elmer)Cycler: thermal cycler (Perkin Elmer)
Note: Total RT volume is 20microL containing 2.5microM primer SW00511, 1U/microL RNase inhibitor (Perkin Elmer), 2.5U/microL MLV RTase (Perkin Elmer), 2.5mM MgCl2, 1.0mM dNTPs, 1x PCR buffer (Perkin Elmer), and 2microL RNA.
RT temperature: 42C 30min>99C 5min>5C 2min.

Total PCR volume is 100microL containing 0.5microM primer SW00510 and all 20microL cDNA.
Forward(SW00510) primer
Oligo type: PCRDegeneracy: 1
Target: 6044-6063Tm: 67.9 C at salt 1000.0mMLength:
Sequence: GAGATGGTCAAGAAGATAAC
(0 other experimental conditions)
Note:
Reverse(SW00511) primer
Oligo type: PCRDegeneracy: 1
Target: 6342-6323Tm: 70 C at salt 1000.0mMLength:
Sequence: TTTGGTTGAGGCATTTGGCA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.