A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0034Publication date: 02/96
PMID: 9054133GI: 9626649 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV; Hog cholera virus (strain Alfort), CSFVProduct size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 3min>(94C 1min>65C 1min>72C 1min)*35
Buffer: 10mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.008U/microL Taq DNA poly (CENBIOT)Cycler: PTC-100 (MJ Research)
Note: Multiplex PCR.
P3/P1 amplifies BVDV [GI:9626649], [Taxonomy:11100].
P3/P2 amplifies CSFV [GI:9626724], [Taxonomy:11097].

Total RT volume is 20microL containing 10mM Tris-HCl (pH 8.4), 50mM KCl, 2.5mM MgCl2, 1.0mM each dNTP, 2.5microM primer P3, and 0.5U/microL MMLV RTase (Gibco-BRL).
RT temperature: 37C 30min.

Total PCR volume is 100microL containing 0.5microM each primer in a multiplex PCR format.
Forward(P1) primer
Oligo type: PCRDegeneracy: 1
Target: 89-113Tm: 83.7 C at salt 1000.0mMLength:
Sequence: GGCCGAAAAGAGGCTAGCCATGCCC
(0 other experimental conditions)
Note: Specific to BVDV, [GI:9626649]
Forward(P2) primer
Oligo type: PCRDegeneracy: 1
Target: 124-147Tm: 85.5 C at salt 1000.0mMLength:
Sequence: CGTAGTGGCGAGCTCCCTGGGTGG
(0 other experimental conditions)
Note: Specific to CSFV [GI:9626724]
Reverse(P3) primer
Oligo type: PCRDegeneracy: 1
Target: 348-324Tm: 85.4 C at salt 1000.0mMLength:
Sequence: TGGGCCTCTGCAGCACCCTCTCAGG
(0 other experimental conditions)
Note: Complementary to all known pestiviruses.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.