A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0024Publication date: 05/96
PMID: 8727882GI: 261087 Taxonomy ID: 10385
Virus Name: Bovine herpesvirus 4, BHV-4Product size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):(94C 45sec>56C 60sec>72C 90sec)*5>(94C 45sec>51C 60sec>72C 90sec)*25>72C 7min
Buffer: 1x PCR buffer
Polymerase: 0.2U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler: TRIO-thermoblock (Biometra; Gottingen, Germany))
Note: Total primary PCR volume is 50microL containing 18ng/microL DNA and 0.3microM each primers 1 and 2.

Article does not mention procedure for nested PCR except that primers 3 and 4 are used.
Forward(primer 1) primer
Oligo type: PCRDegeneracy: 1
Target: 132-153Tm: 78.5 C at salt 1000.0mMLength:
Sequence: GTTGGGCGTCCTGTATGGTAGC
(0 other experimental conditions)
Note: Used with primer 2 for primary PCR.
Reverse(primer 2) primer
Oligo type: PCRDegeneracy: 1
Target: 698-669Tm: 75.2 C at salt 1000.0mMLength:
Sequence: ATGTATGCCCAAAACTTATAATATGACCAG
(1 other experimental conditions)
Note: Used with primer 1 for primary PCR.
Forward(primer 3) primer
Oligo type: PCRDegeneracy: 1
Target: 339-363Tm: 77.2 C at salt 1000.0mMLength:
Sequence: TTGATAGTGCGTTGTTGGGATGTGG
(0 other experimental conditions)
Note: Used with primer 4 for secondary PCR.
Reverse(primer 4) primer
Oligo type: PCRDegeneracy: 1
Target: 598-577Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CACTGCCCGGTGGGAAATAGCA
(0 other experimental conditions)
Note: Used with primer 3 for secondary PCR.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.