A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0022Publication date: 04/96
PMID: 8785714GI: 330756 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):94C 5min>(94C 60sec>55C 90sec>72C 120sec)*30>72C 5min
Buffer: 10mM Tris-HCl (pH8.3), 50mM KCl, 2% formamide
Polymerase: 0.025U/microL Taq DNA poly (Gibco/BRL)Cycler: Robocycler thermocycler
Note: Total primary PCR volume is 100microL containing 5-50microL extracted DNA and 1microM each primers D1 and R1.

Total secondary PCR volume is 100microL containing 10microL primary PCR product and 1microM each primers ND1 and NR1. Secondary PCR conditions are identical to those of primary PCR.
Forward(D1) primer
Oligo type: PCRDegeneracy: 1
Target: 1053-1070Tm: 64 CLength:
Sequence: TACCTGCGCAGCGGGCGC
(0 other experimental conditions)
Note: Used with R1 for primary PCR.
Reverse(R1) primer
Oligo type: PCRDegeneracy: 1
Target: 1662-1642Tm: 76.4 C at salt 1000.0mMLength:
Sequence: CTTGCATCACGCAGTCGCTCA
(0 other experimental conditions)
Note: Used with D1 for primary PCR. Mismatches at positions 1669 and 1670.
Forward(ND1) primer
Oligo type: PCRDegeneracy: 1
Target: 1161-1178Tm: 56 CLength:
Sequence: ACGACGGACGATGTGTAC
(0 other experimental conditions)
Note: Used with NR1 for secondary PCR.
Reverse(NR1) primer
Oligo type: PCRDegeneracy: 1
Target: 1555-1539Tm: 54 CLength:
Sequence: CTCTCGTCTCGCAGCAT
(0 other experimental conditions)
Note: Used with ND1 for secondary PCR.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.