A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0020Publication date: 12/93
PMID: 8308103GI: 330754 Taxonomy ID: 10323
Virus Name: Bovine herpesvirus type 1.1 (strain Cooper)Product size (PCR):
bp
MgCl2: 1.9 mMdNTPs: mMType: PCR
Temp (PCR cycle):(95C 1min>60C 1min>72C 1min)*15>(95C 1min>60C 1min>72C 1min [+4sec/cyc])*23
Buffer: 10mM Tris (pH 9.0), 50mM KCl, 0.01% gelatin, 5% glycerol
Polymerase: 0.01U/microL Taq poly (Boehringer)Cycler: DNA thermal cycler (Perkin-Elmer Cetus)
Note: Total PCR volume is 50microL containing 0.1microM each primer.
Forward(P1) primer
Oligo type: PCRDegeneracy: 1
Target: 763-784Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CAGCTGTTCGTAGCCCACAACG
(0 other experimental conditions)
Note: Mismatch at position 764.
Reverse(P2) primer
Oligo type: PCRDegeneracy: 1
Target: 935-914Tm: 78.5 C at salt 1000.0mMLength:
Sequence: TGTGACTTGGTGCCCATGTCGC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.