A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SW0016Publication date: 05/92
PMID: 1314454GI: 330745 Taxonomy ID: 10323
Virus Name: Bovine herpesvirus type 1.1 (strain Cooper)Product size (PCR): 353 bp
MgCl2: 2.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):(94C 2min>67C 1min>74C 1min)*40>74C 5min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 4.0% dimethyl sulfoxide
Polymerase: 0.025U/microL AmpliTaq poly (Perkin-Elmer Cetus)Cycler: Model 50 Tempcycler (Coy Laboratory Prod. Inc.)
Note: Total PCR volume is 40microL containing 1.0microM each primer and 1microL bovine nasal swab material.
Forward(SW00160) primer
Oligo type: PCRDegeneracy: 1
Target: 318-337Tm: 82.3 C at salt 1000.0mMLength:
Sequence: GGCGCTGATCGCAGACCCGC
(0 other experimental conditions)
Note:
Reverse(SW00161) primer
Oligo type: PCRDegeneracy: 1
Target: 670-650Tm: 84.2 C at salt 1000.0mMLength:
Sequence: CCCCGGCCGGCAGCGAAACCA
(0 other experimental conditions)
Note:
Forward(SW00162) primer
Oligo type:
Degeneracy: 1
Target: 663-680Tm: 60 CLength:
Sequence: AGCCGAGTACCTGCGCAG
(2 other experimental conditions)
Note: Forward primer for second nested PCR
Reverse(SW00163) primer
Oligo type: PCRDegeneracy: 1
Target: 1007-990Tm: 58 CLength:
Sequence: AGCCCTCGATCTGCTGGA
(2 other experimental conditions)
Note: Reverse primer for second nested PCR
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.