A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SK0116Publication date: 1995
PMID: 8789057GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1 WI-38(CCL75); pestivirus type 2 CPA(CCL207)Product size (PCR): 285 bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 30sec>56C 120sec>72C 120sec)*30
Buffer: 1x Buffer (Perkin-Elmer Cetus)
Polymerase: 0.025U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler:
Note: Primers are universal for:
pestivirus type 1 WI-38(CCL75) [Taxonomy:11099]
pestivirus type 2 CPA(CCL207) [Taxonomy:54314]

Total RT volume is 40microL containing RNA, 1x buffer (Gibco-BRL), 10mM dithiothreitol, 0.2mM dNTPs, 0.55U/microL ribonuclease inhibitor (Takara Shuzo, Ltd.), 0.625U/microL MMLV RTase (Gibco-BRL), and 0.25microM primer R1.
RT temperature: 37C 90min.

Total PCR volume is 50microL containing 5microL cDNA and 0.2microM each primer.
Article does not mention addition of MgCl2.
Reverse(R1) primer
Oligo type: Degeneracy: 1
Target: 392-373Tm: 72 C at salt 1000.0mMLength:
Sequence: ACTCCATGTGCCATGTACAG
(5 other experimental conditions)
Note:
Forward(F1) primer
Oligo type: Degeneracy: 4
Target: 108-127Tm: Max Tm 74.1 C Min Tm 72 C at salt 1000.0mMLength:
Sequence: ATGCCC(A/T)(C/T)AGTAGGACTAGC
(4 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.