A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SK0112Publication date: 06/01
PMID: 11377717GI: 871250 Taxonomy ID: 11096
Virus Name: Classical swine fever virus Alfort/187, CSFV-Alfort/187; bovine viral diarrhea virus isolate NADL, BVDV-NADL; Hog cholera virus (strain Brescia), CSFV-BresciaProduct size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):48C 45min>94C 2min>(94C 30sec>60C 60sec>68C 120sec)*40>68C 7min
Buffer: 1x AMV/Tfl reaction buffer, 1mM MgSO4, 0.2mM PCR DIG labelling mix (Boehringer Mannheim)
Polymerase: 0.1U/microL Tfl DNA polyCycler: GeneAmp PCR system 2400 (Perkin Elmer)
Note: Universal PCR. Primer pairs panpest-3F/panpest-4R and pest104F/pest402R amplify the following viruses:
CSFV-Alfort/187 [Taxonomy:11096]
BVDV-NADL [Taxonomy:11100]
CSFV-Brescia [Taxonomy:11098]

Single step RT-PCR is performed in a total volume of 50microL using a ACCESS RT-PCR system (Promega), 2microL RNA sample, 0.4microM each primer in a set, and 0.1U/microL AMV RTase.
Article does not mention addition of MgCl2 and dNTPs in RT-PCR.

Hybridization of probes bvdvpr-1 and csfvpr-1 to products of primer set panpest-3F/panpest-4R and probes pestpr-2 and csfvpr-2 to products of primer set pest104F/pest402R are performed according to manufacturer's instructions (Boehringer Mannheim).

For other RT-PCR in this article, [see SK0111].
Forward(panpest-3F) primer
Oligo type: Degeneracy: 1
Target: 356-380Tm: 78.8 C at salt 1000.0mMLength:
Sequence: CTCTGCTGTACATGGCACATGGAGT
(0 other experimental conditions)
Note: Position given in article is 346-370.
Reverse(panpest-4R) primer
Oligo type: Degeneracy: 16
Target: 1428-1404Tm: Max Tm 77.2 C Min Tm 72.3 C at salt 1000.0mMLength:
Sequence: TACCA(A/G)TT(A/G)CACCA(A/T)CCATG(A/G)TTGT
(0 other experimental conditions)
Note: Target given in article is 1418-1394.
Forward(bvdvpr-1) primer
Oligo type: Degeneracy: 64
Target: 887-917Tm: Max Tm 87.3 C Min Tm 79.3 C at salt 1000.0mMLength:
Sequence: TGCTC(A/C)GACAC(A/G)AAAG(A/C)AGA(A/G)GG(A/G)GC(A/G)ACAA
(0 other experimental conditions)
Note: 5' biotin-labelled probe.
Forward(csfvpr-1) primer
Oligo type: Degeneracy: 16
Target: 823-850Tm: Max Tm 80.6 C Min Tm 74.7 C at salt 1000.0mMLength:
Sequence: AACCCT(A/G)AAGTGGATTAG(A/G)AA(C/T)(C/T)TCACC
(0 other experimental conditions)
Note: 5' biotin-labelled probe. Target given in article is 813-850. Specific to classical swine fever viruses, [GI:871250].
Forward(pest104F) primer
Oligo type: Degeneracy: 1
Target: 101-124Tm: 78.7 C at salt 1000.0mMLength:
Sequence: GCTAGCCATGCCCTTAGTAGGACT
(1 other experimental conditions)
Note: Specific to 5'-UTR. Used with pest402R.
Reverse(pest402R) primer
Oligo type: Degeneracy: 1
Target: 394-371Tm: 77 C at salt 1000.0mMLength:
Sequence: CAACTCCATGTGCCATGTACAGCA
(1 other experimental conditions)
Note: Specific to 5'-UTR. Used with pest104F.
Forward(csfvpr-2) primer
Oligo type: Degeneracy: 4
Target: 286-309Tm: Max Tm 77 C Min Tm 73.6 C at salt 1000.0mMLength:
Sequence: TCACATTA(C/T)GTGATGGG(A/G)GTACGA
(1 other experimental conditions)
Note: Specific to 5'-UTR. 5' biotin-labelled probe. Target given in article is 276-299. Specific to classical swine fever viruses, [GI:871250].
Forward(pestpr-2) primer
Oligo type: Degeneracy: 4
Target: 176-197Tm: Max Tm 78.5 C Min Tm 74.7 C at salt 1000.0mMLength:
Sequence: CCTGAGTACAGG(A/G)(C/T)AGTCGTCA
(1 other experimental conditions)
Note: Specific to 5'-UTR. 5' biotin-labelled probe.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.