A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SK0111Publication date: 06/01
PMID: 11377717GI: 871250 Taxonomy ID: 11096
Virus Name: Classical swine fever virus Alfort/187, CSFV-Alfort/187; bovine viral diarrhea virus isolate NADL, BVDV-NADL; Hog cholera virus (strain Brescia), CSFV-BresciaProduct size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):60C 60min>94C 3min>(94C 30sec>60C 60sec)*40>60C 7min
Buffer: 1x EZ buffer, 2.5mM Mn(OAc)2, 0.01mM DIG-dUTP (Boehringer Mannheim)
Polymerase: 0.1U/microL rTth DNA polyCycler: GeneAmp PCR system 2400 (Perkin Elmer)
Note: Universal PCR. Primer pair pest104F/pest402R amplifies the following viruses:
CSFV-Alfort/187 [Taxonomy:11096]
BVDV-NADL [Taxonomy:11100]
CSFV-Brescia [Taxonomy:11098]

Single step RT-PCR is performed in a total volume of 50microL using GeneAmp EZ-rTth RNA PCR kit (Perkin Elmer), 2microL RNA sample, and 0.4microM each primer.
For dNTPs, 0.2mM each dATP, dCTP, and dGTP are used with 0.19mM dTTP.
Article does not mention addition of MgCl2 to RT-PCR.

Hybridizations of probes pestpr-2 and csfvpr-2 to products of primer set pest104F/pest402 are performed according to manufacturer's instructions (Boehringer Mannheim).

For other RT-PCR in this article, [see SK0112].
Forward(pest104F) primer
Oligo type: Degeneracy: 1
Target: 101-124Tm: 78.7 C at salt 1000.0mMLength:
Sequence: GCTAGCCATGCCCTTAGTAGGACT
(1 other experimental conditions)
Note: Specific to 5'-UTR. Used with pest402R.
Reverse(pest402R) primer
Oligo type: Degeneracy: 1
Target: 394-371Tm: 77 C at salt 1000.0mMLength:
Sequence: CAACTCCATGTGCCATGTACAGCA
(1 other experimental conditions)
Note: Specific to 5'-UTR. Used with pest104F.
Forward(csfvpr-2) primer
Oligo type: Degeneracy: 4
Target: 286-309Tm: Max Tm 77 C Min Tm 73.6 C at salt 1000.0mMLength:
Sequence: TCACATTA(C/T)GTGATGGG(A/G)GTACGA
(1 other experimental conditions)
Note: Specific to 5'-UTR. 5' biotin-labelled probe. Target given in article is 276-299. Specific to classical swine fever viruses, [GI:871250].
Forward(pestpr-2) primer
Oligo type: Degeneracy: 4
Target: 176-197Tm: Max Tm 78.5 C Min Tm 74.7 C at salt 1000.0mMLength:
Sequence: CCTGAGTACAGG(A/G)(C/T)AGTCGTCA
(1 other experimental conditions)
Note: Specific to 5'-UTR. 5' biotin-labelled probe.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.