A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SK0102Publication date: 06/99
PMID: 10325368GI: 323205 Taxonomy ID: 11099
Virus Name: pestivirus type 1, BVDV1; Bovine viral diarrhea virus genotype 2, BVDV2Product size (PCR):
bp
MgCl2: 2.0 mMdNTPs: mMType: RT-Nested PCR
Temp (PCR cycle):(94C 20sec>50C 30sec>72C 30sec)*40>72C 15min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.025U/microL Taq DNA poly (Canadian Life Technologies)Cycler:
Note: Primer set PN00395/PN00393 (360bp product) is specific to BVDV1 [Taxonomy:11099]
Primer set PN00395/PN00394 (604bp-product) is specific to BVDV2 [Taxonomy:54315].

RT and primary PCR are performed in a single step in a final volume of 50microL containing 1.0microL RNA, 5.0ng/microL each primers PN00391 and PN00392, 0.1U/microL RNAguard RNase inhibitor (Pharmacia), and 1U/microL MMLV RTase (Canadian Life Technologies).
RT-PCR cycle: 37C 30min>94C 3min>(94C 20sec>50C 30sec>72C 30sec)*25>72C 15min.

Secondary PCR uses 1microL primary PCR product and 5.0ng/microL each primers PN00393, PN00394, and PN00395 in a multiplex PCR format.
Secondary PCR conditions are identical to those of primary PCR except no RTase or RNAguard are used.
Forward(PN00391) primer
Oligo type: Degeneracy: 2
Target: 10385-10404Tm: Max Tm 72 C Min Tm 70 C at salt 1000.0mMLength:
Sequence: AAGATCCACCCTTATGA(A/G)GC
(1 other experimental conditions)
Note: Mismatches at positions 10390 and 10396. Used with PN00392 in primary PCR.
Reverse(PN00392) primer
Oligo type: Degeneracy: 2
Target: 11547-11528Tm: Max Tm 72 C Min Tm 70 C at salt 1000.0mMLength:
Sequence: AAGAAGCCATCATC(A/C)CCACA
(0 other experimental conditions)
Note: Used with PN00391 in primary PCR.
Forward(PN00393) primer
Oligo type: Degeneracy: 1
Target: 10758-10779Tm: 71 C at salt 1000.0mMLength:
Sequence: TGGAGATCTTTCACACAATAGC
(1 other experimental conditions)
Note: Mismatches at positions 10765, 10769, and 10774. BVDV1 specific, [GI:323205].
Forward(PN00394) primer
Oligo type: Degeneracy: 1
Target: 10469-10488Tm: 67.9 C at salt 1000.0mMLength:
Sequence: GGGAACCTAAGAACTAAATC
(1 other experimental conditions)
Note: Multiple mismatches. BVDV2 specific, [GI:902376].
Reverse(PN00395) primer
Oligo type: Degeneracy: 2
Target: 11117-11096Tm: Max Tm 72.9 C Min Tm 71 C at salt 1000.0mMLength:
Sequence: GCTGTTTCACCCAGTT(A/G)TACAT
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.