A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SK0065Publication date: 08/01
PMID: 11390104GI: 9626649 Taxonomy ID: 11099
Virus Name: Pestivirus type 1Product size (PCR): 288 bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):60C 30min>94C 1min>(94C 15sec>63C 40sec)*40>63C 7min
Buffer: 2.5mM Mn(OAc)2
Polymerase: 0.1U/microL rTth DNA poly (Perkin-Elmer)Cycler: GeneAmp PCR system 2400 (Perkin-Elmer)
Note: Primer pair 324/326 is referenced to Vilcek et al., 1994 [PMID:8031236].

A single step RT-PCR is performed using GeneAmp EZ rTth RNA PCR kit (Perkin-Elmer).
Total RT-PCR volume is 25microL containing 0.5microL RNA and 0.8microM each primer.
Article does not mention MgCl2 and other buffer reagents.
Forward(PN00285) primer
Oligo type: Degeneracy: 2
Target: 108-128Tm: 73.9 C at salt 1000.0mMLength:
Sequence: ATGCCC(A/T)TAGTAGGACTAGCA
(6 other experimental conditions)
Note:
Reverse(PN00286) primer
Oligo type: Degeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.