A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SK0064Publication date: 11/00
PMID: 11085469GI: 7960753 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), NADL; pestivirus type 1 strain CS8644, CS8644Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: Universal RT-PCR
Temp (PCR cycle):50C 45min>94C 2min>50C 4min>72C 5min>(94C 0.5min>50C 2min>72C 5min)*35>72C 15min
Buffer: 20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH4)2SO4, 2.0mM MgSO4, 0.1% Triton X-100, 10ng/microL BSA, 5mM DTT
Polymerase: 0.02U/microL AmpliTaq DNA poly (Perkin-Elmer Biosystems)Cycler: 2400, 9600 or 9700 thermocycler (Perkin-Elmer Biosystems)
Note: Universal PCR. Primers amplify the following virsues:
isolate NADL [Taxonomy:11100] a genotype I bovine viral diarrhea virus.
strain CS8644 [Taxonomy:11099] a genotype II bovine viral diarrhea virus.

Single step RT-PCR is performed in a total volume of 100microL containing 0.2U/microL RNasin (Promega), 0.015U/microL RAV-2 RTase (Amersham Pharmacia Biotech), 0.025U/microL TaqExtender PCR Additive (Stratagene), 1.0mM each primer, and 5microL RNA.
Article does not mention addition of MgCl2 in RT-PCR.
Forward(BVD324) primer
Oligo type: Degeneracy: 2
Target: 108-128Tm: 73.9 C at salt 1000.0mMLength:
Sequence: ATGCCC(A/T)TAGTAGGACTAGCA
(6 other experimental conditions)
Note:
Reverse(BVD326) primer
Oligo type: Degeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.