A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SK0002Publication date: 04/95
PMID: 7667908GI: 9626649 Taxonomy ID: 31656
Virus Name: Bovine viral diarrhea virus (strain SD-1), BVDV strain SD-1Product size (PCR):
bp
MgCl2: 2.2 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 4min>(94C 1min>55C 1.5min>72C 3min)*30>72C 7min
Buffer: 18mM Tris-HCl (pH 8.3), 55mM KCl, 2mM dithiothreitol
Polymerase: 0.025U/microL AmpliTaq poly (Perkin-Elmer Cetus Corp.)Cycler: DNA thermal cycler (Coy Laboratory Products Inc.; Ann Arbor, MI)
Note: Each primer set 5'UTR 1/5'UTR 2 (246bp-product) and p80 1/p80 2 (1153bp-product) are used in separate reactions.

Total RT volume is 20microL containing 8.5microL extracted RNA, 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 10mM dithiothreitol, 1.0mM dNTPs, 1U/microL RNasin, 15ng/microL random hexanucleotide, and 10U/microL MMLV RTase.
RT temperature: 37C 60min>75C 10min

Total PCR volume is 100microL containing all 20microL cDNA and 1.25microM primer in a set.
Article does not mention addition of dNTPs in PCR.
Forward(5'UTR 1) primer
Oligo type: Degeneracy: 1
Target: 100-117Tm: 58 CLength:
Sequence: GGCTAGCCATGCCCTTAG
(4 other experimental conditions)
Note: Used with 5'UTR 2.
Reverse(5'UTR 2) primer
Oligo type: Degeneracy: 1
Target: 345-328Tm: 58 CLength:
Sequence: GCCTCTGCAGCACCCTAT
(1 other experimental conditions)
Note: Used with 5'UTR 1.
Forward(p80 1) primer
Oligo type: Degeneracy: 1
Target: 6322-6345Tm: 77 C at salt 1000.0mMLength:
Sequence: CTGCCAAATGCCTCAACCAAAGCT
(2 other experimental conditions)
Note: Used with p80 2.
Reverse(p80 2) primer
Oligo type: Degeneracy: 1
Target: 7474-7451Tm: 80.4 C at salt 1000.0mMLength:
Sequence: GGACAACCCGGTCACTTGCTTCAG
(2 other experimental conditions)
Note: Used with p80 1.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.