A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SH0009Publication date: 09/94
PMID: 7814551GI: 9631267 Taxonomy ID: 11246
Virus Name: Bovine respiratory syncytial virus, BRSV Product size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: RT-Nested PCR
Temp (PCR cycle):(94C 45sec>50C 45sec>72C 90sec)*25>72C 6min
Buffer: 10mM Tris-HCl (pH 9.0), 50 mM KCl, 100ng/microL BSA
Polymerase: 0.02U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: Primer sets B1/B2A (711bp-product) and B3/B4A (481bp-product) are specific to fusion glycoprotein of BRSV.
Primer sets B5A-B6A (603bp-product) and B7A/B8 (371bp-product) are specific to attachment glycoprotein of BRSV.

Article uses mL instead of microL.

15mL containing 2mL RNA and 0.0013U/mL random hexamers (Pharmacia) are incubated 65C 5min and then cooled on ice.
Total RT volume is 25mL containing RNA-primer mixture, 0.96U/mL RNAguard (Pharmacia), 0.2mM each dNTPs, 50mM Tris-HCl (pH 8.3), 75mM KCl, 3.0mM MgCl2, and 8U/mL MMLV RTase (Gibco BRL).
RT temperature: 37C 90min>98C5min

Total primary PCR volume is 50mL containing 5mL cDNA and 0.03nM each primer in a set (B1/B2A or B5A/B6A).

Total secondary PCR volume is 50microL containing 5mL primary PCR product and 0.3nM each primer in a set (B3/B4A or B7A/B8).
Secondary PCR conditions are identical to primary PCR conditions except for primer concentrations.

PCR products are transferred onto nylon membranes (Hybond N+; Amersham) and fixed. Samples are hybridized (withouth prehybridization) in plastic bags containing 0.2% BSA, 0.2% Ficoll 400, 0.2% polyvinylpyrrolidone, 1700microg/mL yeast tRNA in 2x SSC, and 33nM biotinylated probe F or G.
Hybridization temperature: 45C 30min.
Forward(B1) primer
Oligo type: PCRDegeneracy: 1
Target: 5670-5691Tm: 71 C at salt 1000.0mMLength:
Sequence: AATCAACATGCAGTGCAGTTAG
(1 other experimental conditions)
Note: Used with B2A for primary PCR. BLAST position differs than that in article (114-135).
Reverse(B2A) primer
Oligo type: PCRDegeneracy: 1
Target: 6380-6359Tm: 69.1 C at salt 1000.0mMLength:
Sequence: TTTGGTCATTCGTTATAGGCAT
(1 other experimental conditions)
Note: Used with B1 for primary PCR. BLAST position differs than that in article (824-803).
Forward(B3) primer
Oligo type: PCRDegeneracy: 1
Target: 5682-5707Tm: 74.2 C at salt 1000.0mMLength:
Sequence: GTGCAGTTAGTAGAGGTTATCTTAGT
(1 other experimental conditions)
Note: Used with B4A in secondary PCR. BLAST position differs than that in article (126-151).
Reverse(B4A) primer
Oligo type: PCRDegeneracy: 1
Target: 6162-6137Tm: 71 C at salt 1000.0mMLength:
Sequence: TAGTTCTTTAGATCAAGTACTTTGCT
(1 other experimental conditions)
Note: Used with B3 in secondary PCR. BLAST position differs than that in article (606-581).
Forward(Probe F) primer
Oligo type: HybridizationDegeneracy: 1
Target: 5881-5910Tm: 79.3 C at salt 1000.0mMLength:
Sequence: CAGTAGAGCAAAAAGAGGGATACCAGAGTT
(0 other experimental conditions)
Note: BLAST position differs than that in article (325-354).
Forward(B5A) primer
Oligo type: PCRDegeneracy: 1
Target: 4835-4859Tm: 77.2 C at salt 1000.0mMLength:
Sequence: CCACCCTAGCAATGATAACCTTGAC
(2 other experimental conditions)
Note: Used with B6A in primary PCR. BLAST position differs than that in article (110-134).
Reverse(B6A) primer
Oligo type: PCRDegeneracy: 2
Target: 5437-5416Tm: Max Tm 76.6 C Min Tm 74.7 C at salt 1000.0mMLength:
Sequence: AAGAGAGGATGC(T/C)TTGCTGTGG
(1 other experimental conditions)
Note: Used with B5A in primary PCR. BLAST position differs than that in article (712-691).
Forward(B7A) primer
Oligo type: Degeneracy: 1
Target: 5006-5030Tm: 77.2 C at salt 1000.0mMLength:
Sequence: CATCAATCCAAAGCACCACACTGTC
(3 other experimental conditions)
Note: Used with B8 for secondary PCR. BLAST position differs from that in article (281-305).
Reverse(B8) primer
Oligo type: PCRDegeneracy: 1
Target: 5376-5352Tm: 77.2 C at salt 1000.0mMLength:
Sequence: GCTAGTTCTGTGGTGGATTGTTGTC
(3 other experimental conditions)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).
Forward(Probe G) primer
Oligo type: HybridizationDegeneracy: 1
Target: 5279-5309Tm: 86 C at salt 1000.0mMLength:
Sequence: GAGCACCAAGCAGAGCCCCTACAATCACCCT
(0 other experimental conditions)
Note: BLAST position differs than that in article (554-584).
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.