A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0152Publication date: 04/04
PMID: 15031782GI: 38505482 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Nested RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler: LightCycler (Roche Biomedical Laboratories)
Note: The reaction was performed using RealArt HPA-Coronavirus LC RT-PCR Reagents (Roche Biomedical Laboratories). The reaction was cited as the same as described in (Drosten et al. (2003) [PMID: 12690091].
Forward(SG015201) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15239-15257Tm: 71.5C at salt 1000.0 mMLength:
Sequence: CAGAGCCATGCCTAACATG
(1 other experimental conditions)
Note: Outside Primer
Reverse(SG015202) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15627-15608Tm: 70C at salt 1000.0 mMLength:
Sequence: AATGTTTACGCAGGTAAGCG
(1 other experimental conditions)
Note: Outside Primer
Forward(SG015203) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15376-15393Tm: 52CLength:
Sequence: TGTTAAACCAGGTGGAAC
(0 other experimental conditions)
Note:
Reverse(SG015204) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15532-15515Tm: 54CLength:
Sequence: CCTGTGTTGTAGATTGCG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.