A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0151Publication date: 07/04
PMID: 15243096GI: 38505482 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Multiplex PCR
Temp (PCR cycle):95C 180sec>(95C 60sec>50C 60sec>72C 60sec)*35
Buffer: 5microL master buffer (Bio-ID Diagnostic Inc.)
Polymerase: 5U Taq poly (Roche Diagnostic)Cycler:
Note:
Reverse(GeneNb) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 28556-28536Tm: 70.5C at salt 1000.0 mMLength:
Sequence: ATGTGGTCTTTGGGTGTATTC
(0 other experimental conditions)
Note:
Forward(GeneNa) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28381-28401Tm: 76.4C at salt 1000.0 mMLength:
Sequence: CGAAGAGCTACCCGACGAGTT
(0 other experimental conditions)
Note:
Reverse(GeneMb) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 26801-26781Tm: 74.4C at salt 1000.0 mMLength:
Sequence: TCACTTTCCATGAGCGGTCTG
(0 other experimental conditions)
Note:
Forward(GeneMa) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 26612-26632Tm: 76.4C at salt 1000.0 mMLength:
Sequence: ATTGGGTGACTGGCGGGATTG
(0 other experimental conditions)
Note:
Reverse(SpikeB) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 24650-24630Tm: 76.4C at salt 1000.0 mMLength:
Sequence: CTGGGATGGCACATACGTGAC
(0 other experimental conditions)
Note:
Forward(SpikeA) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 24493-24510Tm: 54CLength:
Sequence: GGGCTTCTGCTAATCTTG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.