A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0149Publication date: 05/04
PMID: 15131168GI: 33114190 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):50C 600sec>95C 180sec>(95C 2sec>55C 12sec>72C 10sec)*50
Buffer:
Polymerase: Cycler:
Note: The reaction mix also contained 0.6microL of reverse transcription-Taq mix (Superscript II RT/Platinum One-Step RT-PCR kit, Invitrogen), 3.6mM magnesium sulfate, and 1 microG of bovine serum albumin (Sigma).
Forward(SANS1) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28161-28181Tm: 72.5C at salt 1000.0 mMLength:
Sequence: TGGACCCACAGATTCAACTGA
(0 other experimental conditions)
Note:
Forward(SANP1) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 28185-28208Tm: 77C at salt 1000.0 mMLength:
Sequence: TAACCAGAATGGAGGACGCAATGG
(0 other experimental conditions)
Note: This probe has a 6-carboxyfluorescein on the 5' end and a 6-carboxy-N,N,N',N'-tetramethylrhodamine on the 3' end
Reverse(SANPAs2) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 28271-28250Tm: 74.7C at salt 1000.0 mMLength:
Sequence: GCTGTGAACCAAGACGCAGTAT
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.