A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0145Publication date: 05/05
PMID: 15131175GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS CoronavirusProduct size (PCR): 180 bp
MgCl2: mMdNTPs: mMType: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: This assay is a Roche assay and is performed using the manufacturer's instructions. The reaction mix contained 5microL of RNA extract.
Forward(BNIoutS2) primer
Oligo type: PCRDegeneracy: 1
Target: 18153-18176Tm: 70.2 C at salt 1000.0mMLength:
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.
Reverse(BNIouutAs) primer
Oligo type: PCRDegeneracy: 1
Target: 18342-18322Tm: 72.5 C at salt 1000.0mMLength:
Sequence: CATAACCAGTCGGTACAGCTA
(1 other experimental conditions)
Note: Target range from sequence.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.