A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0144Publication date: 05/05
PMID: 15131175GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS CoronavirusProduct size (PCR): 80 bp
MgCl2: mMdNTPs: mMType: Q-RT-PCR
Temp (PCR cycle):95C 10sec>(95C 2sec>55C 12sec>72C10sec)*50>40C 30sec
Buffer:
Polymerase: Cycler:
Note: The Real-Time Quantitative Assay was perfomred using a ready to use assay called the Artus assay. The reaction was performed using the instructions of the manufacturer.
Forward(BNITMSARS1) primer
Oligo type: PCRDegeneracy: 1
Target: 18187-18206Tm: 72 C at salt 1000.0mMLength:
Sequence: TTATCACCCGCGAAGAAGCT
(2 other experimental conditions)
Note: Target range from sequence.
Reverse(BNITMSARAs2) primer
Oligo type: PCRDegeneracy: 1
Target: 18264-18243Tm: 76.6 C at salt 1000.0mMLength:
Sequence: CTCTAGTTGCATGACAGCCCTC
(2 other experimental conditions)
Note: Target range from sequence.
Forward(BNITMSARP) primer
Oligo type:
Degeneracy: 1
Target: 18218-18241Tm: 77 C at salt 1000.0mMLength:
Sequence: TCGTGCGTGGATTGGCTTTGATGT
(2 other experimental conditions)
Note: 5' end conjugated with 6-carboxyfluorescein, 3' end with 6-carboxy-N,N,N',N'-tetramethylrhodamin
Target range from sequence.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.