A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0138Publication date: 05/04
PMID: 15131152GI: 5830555 Taxonomy ID: 10255
Virus Name: Variola virusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Real-time PCR
Temp (PCR cycle):95C 10sec>(95C 5sec>55C 15sec>72C 15sec)*45
Buffer:
Polymerase: Cycler: LightCycler (Roche Diagnostics)
Note: The reaction was performed using a PCR master mixture containing Taq polymerase, reaction buffer, dNTP mixture, bovine serum albumin (Artus), and 5microL of template DNA.
Forward(Pox fw 14kd 1) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 131791-131812Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CCGICCAGTCTGAACATCAATC
(0 other experimental conditions)
Note: Set 1
Forward(Pox fw 14kd 2) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 131791-131812Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CCGACCAGTCTGIACATCAATC
(0 other experimental conditions)
Note:
Reverse(Pox RT 14kb 1) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 131911-131885Tm: 71.4C at salt 1000.0 mMLength:
Sequence: ACAAATIGAAAAGTGTTGTAAACGCAA
(0 other experimental conditions)
Note: Set 1
Reverse(Pox RT 14kd 2) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 131911-131885Tm: 69.9C at salt 1000.0 mMLength:
Sequence: ACAAATAGAAAAGTGTTGTAAACICAA
(0 other experimental conditions)
Note: Set 2
Forward(Anchor probe Pox Anc) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 131821-131860Tm: 83.9C at salt 1000.0 mMLength:
Sequence: CAGAGATATCATAGCCGCTCTTAGAGTTTCAGCGTGATTT
(0 other experimental conditions)
Note:
Forward(Sensor probe MGB pox 14kd) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 131862-131882Tm: 66.6C at salt 1000.0 mMLength:
Sequence: CCAACCTAAATAGIACTTCAT
(0 other experimental conditions)
Note: This probe has a 6-carboxyfluorescein group on the 5'end and a Quencher on the 3'end. One discrepancy was found in Blast search the nucleotide at 131872 was a G instead of a T as reported by the article.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.