A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0131Publication date: 12/03
PMID: 14662982GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 1281 bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: This article gives no data on how the RT-PCR was carried out. The sample used was a blood sample from a SARS patient in Beijing.
Forward(SG013101) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28126-28150Tm: 77.2C at salt 1000.0 mMLength:
Sequence: CGCATATGTCTGATAATGGACCCCA
(0 other experimental conditions)
Note:
Forward(SG013102) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 29407-29379Tm: 80.6C at salt 1000.0 mMLength:
Sequence: CGGATCCTTATGCCTGAGTTGAATCAGCA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.