A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0130Publication date: 10/03
PMID: 14532176GI: 37960831 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 108 bp
MgCl2: 2.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 300sec>(95C 10sec>60C (-1C/cyc) 10sec>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*20
Buffer: 1x reaction buffer
Polymerase: 2U AmpliTaq GoldCycler:
Note: The reaction mix also contained 1microL of RT-PCR product from the first PCR (SG0129).
Forward(BNIinS) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18202-18221Tm: 72C at salt 1000.0 mMLength:
Sequence: GAAGCTATTCGTCACGTTCG
(7 other experimental conditions)
Note: Nested Primer
Reverse(BNIAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18310-18289Tm: 72.9C at salt 1000.0 mMLength:
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.