A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0129Publication date: 10/03
PMID: 14532176GI: 37960831 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 189 bp
MgCl2: 2.45 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note: The reaction mixture also contained 0.4microL of RTA-Taq and 2microL RNA extract.
Forward(BNIoutS) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18154-18177Tm: 70.2C at salt 1000.0 mMLength:
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:
Reverse(BNoutAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18343-18322Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CATAACCAGTCGGTACAGCTAC
(11 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.