A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0123Publication date: 02/04
PMID: 15030680GI: 33578015 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 195 bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 10sec>56C 10sec>72C 20sec)*50>72C 420sec
Buffer:
Polymerase: Cycler:
Note: The PCR was carried out using a Qiagen OneStep RT-PCR kit (Qiagen).
Forward(BNIoutS2) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18153-18176Tm: 70.2C at salt 1000.0 mMLength:
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:
Reverse(BNIoutAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18342-18321Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CATAACCAGTCGGTACAGCTAC
(11 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.