A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0122Publication date: 02/04
PMID: 15030680GI: 38231927 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(94C 15sec>50C 30sec>72C 30sec>72C 420sec)*50
Buffer:
Polymerase: Cycler:
Note: The reaction was done using a OneStep RT-PCR kit (Qiagen)
Forward(SG012201) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15226-15244Tm: 71.5C at salt 1000.0 mMLength:
Sequence: CAGAGCCATGCCTAACATG
(1 other experimental conditions)
Note:
Reverse(SG012202) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15614-15595Tm: 70C at salt 1000.0 mMLength:
Sequence: AATGTTTACGCAGGTAAGCG
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.