A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0118Publication date: 07/04
PMID: 15324554GI: 30248028 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 133 bp
MgCl2: mMdNTPs: mMType: Real-time RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 15sec>60C 30sec)*45
Buffer:
Polymerase: Cycler: Applied Biosystems real-time PCR systems SDS7700 SDS7000 (Applied Biosystems)
Note: The reaction mix also included 2xQuantiTect Probe RT-PCR Master Mix (Qiagen), 0.25 microL of QuantiTect Probe RT Mix, and 2microL of RNA.
Forward(pp1a F) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 4609-4631Tm: 76.8C at salt 1000.0 mMLength:
Sequence: GCCGTAGTGTCAGTATCATCACC
(1 other experimental conditions)
Note:
Reverse(pp1a R) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 4741-4717Tm: 75.5C at salt 1000.0 mMLength:
Sequence: AATAGGACCAATCTCTGTAAGAGCC
(1 other experimental conditions)
Note:
Forward(pp1a TM) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 4662-4690Tm: 80.6C at salt 1000.0 mMLength:
Sequence: TCACTTCGTCATCAAAGACATCGAGGAGC
(1 other experimental conditions)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 4683.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.