A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0113Publication date: 10/03
PMID: 14532175GI: 33772319 Taxonomy ID: 35244
Virus Name: Bovine herpesvirus 5Product size (PCR): 273 bp
MgCl2: 1 mMdNTPs: mMType: PCR
Temp (PCR cycle):94C 600sec>(94C 60sec>50C 30sec>72C 30sec)*40>72C 420sec
Buffer: 1x reaction buffer
Polymerase: 0.5U Taq poly (GIBCO BRL)Cycler:
Note: The reaction mix also contained 1microL of template DNA and 10% DMSO.
Forward(SG011301) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 57372-57392Tm: 80.3C at salt 1000.0 mMLength:
Sequence: GTGGTGGCCTTTGACCGCGAC
(0 other experimental conditions)
Note:
Reverse(SG011302) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 57666-57645Tm: 82.2C at salt 1000.0 mMLength:
Sequence: GCTCCGGCGAGTAGCTGGTGTG
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.