A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0111Publication date: 08/03
PMID: 12904397GI: 623595 Taxonomy ID: 12870
Virus Name: Variola major virusProduct size (PCR): bp
MgCl2: 5 mMdNTPs: mMType: Real-time PCR
Temp (PCR cycle):95C 120sec>(95C 10sec>60C 45sec)*45
Buffer: 50mM Tris (pH 8.3), 25microG bovine serum albumin per ml
Polymerase: 1.35U Platinum Taq poly (Invitrogen)Cycler: Smart Cycler
Note: The reaction also included170nM TaqMan probe and 5 microL of template DNA.
Forward(OPXJ7R3U) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 151629-151649Tm: 70.5C at salt 1000.0 mMLength:
Sequence: TCATCTGGAGAATCCACAACA
(1 other experimental conditions)
Note:
Reverse(OPXJ7R3L) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 151767-151748Tm: 67.9C at salt 1000.0 mMLength:
Sequence: CATCATTGGCGGTTGATTTA
(1 other experimental conditions)
Note:
Forward(VARJ7R3P) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 151652-151677Tm: 75.8C at salt 1000.0 mMLength:
Sequence: CAAGACGTCGGGACCAATTACTAATA
(1 other experimental conditions)
Note: The probe contains a 6-carboxyfluorescein at the 5' end and a 6-carboxytetramethylrhodamine and a phosphate at the 3' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.