A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0105Publication date: 03/04
PMID: 15004077GI: 456758 Taxonomy ID: 10255
Virus Name: Variola virusProduct size (PCR): bp
MgCl2: 5 mMdNTPs: mMType: Real-time PCR
Temp (PCR cycle):95C 600sec>(95C 10sec>55C 10sec>72C 10sec)*45
Buffer:
Polymerase: Cycler:
Note: The reaction mix also included 10pmol of each primer (TIB Molbiol), 3pmol hybridization probe (TIB Molbiol), 2microL of LightCycler-Fast DNA master hybridization probes mix (Roche), and 5microL of DNA.
Forward(rpo OPV F1) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 93663-93686Tm: 73.6C at salt 1000.0 mMLength:
Sequence: CTGTAGTTATAAACGTTCCGTGTG
(0 other experimental conditions)
Note:
Reverse(rpo OPV R1) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 93867-93844Tm: 70.2C at salt 1000.0 mMLength:
Sequence: TTATCATACGCATTACCATTTCGA
(0 other experimental conditions)
Note:
Reverse(rpo Var302 Sen) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 93785-93758Tm: 73.3C at salt 1000.0 mMLength:
Sequence: AGATTAAATCTCCGCATTGAATAGTTAC
(0 other experimental conditions)
Note: Has a fluorescein at the 3' end.
Reverse(rpo Var302 Anc) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 93756-93725Tm: 75.6C at salt 1000.0 mMLength:
Sequence: TTTGATTCATCTTCGATGTTTAATGTTCCTCT
(0 other experimental conditions)
Note: Has a LC Red640 group on the 5' end and a 3' phoshate to prevent extension.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.