A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0101Publication date: 06/04
PMID: 15144898GI: 38385714 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: This article neither gave nor cited common data for the PCR.
Forward(ORF1-F) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 991-1010Tm: 76.1C at salt 1000.0 mMLength:
Sequence: AGCTACGAGCACCAGACACC
(0 other experimental conditions)
Note:
Reverse(ORF1-R) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 1066-1048Tm: 69.3C at salt 1000.0 mMLength:
Sequence: ACTTTGGGCATTCCCCTTT
(0 other experimental conditions)
Note:
Forward(ORF1-probe) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 1013-1046Tm: 77.1C at salt 1000.0 mMLength:
Sequence: TCGAAATTAAGAGTGCCAAGAAATTTGACACTTT
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.