A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0100Publication date: 03/04
PMID: 15004042GI: 30027617 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 66 bp
MgCl2: mMdNTPs: mMType: Real-time PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>60C 60sec)*40
Buffer:
Polymerase: Cycler: ABI Prism 7700 (Applied Biosystems)
Note: The reaction mix also contained 25microL of TaqMan Universal master mix (Applied Biosystems).
Forward(SG010001) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28531-28552Tm: 74.7C at salt 1000.0 mMLength:
Sequence: GGAGCCTTGAATACACCCAAAG
(1 other experimental conditions)
Note:
Reverse(SG010002) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 28597-28581Tm: 56CLength:
Sequence: GCACGGTGGCAGCATTG
(1 other experimental conditions)
Note:
Forward(SG010003) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 28554-28579Tm: 78.9C at salt 1000.0 mMLength:
Sequence: CCACATTGGCACCCGCAATCCTAATA
(0 other experimental conditions)
Note: On the 5' end there is a fluorescein and a tetramethylrhodamine on the 3' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.