A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0099Publication date: 01/04
PMID: 14715775GI: 37960831 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 110 bp
MgCl2: mMdNTPs: mMType: Nested RT-PCR
Temp (PCR cycle):94C 10sec>(94C 10sec>50C 30sec>72C 60sec)*35>72C 420sec
Buffer:
Polymerase: Cycler:
Note: The PCR was performed with 2.5microL of cDNA and a Expand High-Fidelity PCR system (Roche). The nested primers used the same system but used 2.5microL of the first product in place of cDNA.
Forward(SG009901) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15387-15407Tm: 68.5C at salt 1000.0 mMLength:
Sequence: ACTATATGTTAAACCAGGTGG
(0 other experimental conditions)
Note: Nested Primer.
Reverse(SG009902) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15485-15465Tm: 68.5C at salt 1000.0 mMLength:
Sequence: ATTTACATTGGCTGTAACAGC
(0 other experimental conditions)
Note: Nested Primer.
Reverse(SG009903) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15657-15634Tm: 71.9C at salt 1000.0 mMLength:
Sequence: GGCATCATCAGAAAGAATCATCAT
(0 other experimental conditions)
Note: Outer primer. This is the primer used in the RT.
Forward(SG009904) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15217-15239Tm: 71.5C at salt 1000.0 mMLength:
Sequence: GGTTGGGATTATCCAAAATGTGA
(0 other experimental conditions)
Note: Outside primer.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.