A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0091Publication date: 2003
PMID: 14522061GI: 3796831 Taxonomy ID: 227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note: The reaction mix also contained 5microL of DNA. 2microL from the first PCR were used as templates for the second round of amplifcation. The conditions for the second round were the same except the primers used were BNIinS and BNIinAs. Also the last 40 cycles in the first round were cut down to 25 cycles in the second round.
Forward(BNIoutS2) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18153-18176Tm: 70.2C at salt 1000.0 mMLength:
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:
Reverse(BNIoutAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18342-18321Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CATAACCAGTCGGTACAGCTAC
(11 other experimental conditions)
Note:
Forward(BNIinS) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18202-18221Tm: 72C at salt 1000.0 mMLength:
Sequence: GAAGCTATTCGTCACGTTCG
(7 other experimental conditions)
Note: Nested Primer
Reverse(BNIAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18310-18289Tm: 72.9C at salt 1000.0 mMLength:
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.