A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0090Publication date: 2003
PMID: 14522060GI: 38505491 Taxonomy ID: 227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 5.5 mMdNTPs: mMType: Real-time RT-PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>60C 60sec)*45
Buffer: 1x Taqman buffer A
Polymerase: 0.625U AmpliTaq Gold poly (Applied Biosystems)Cycler: 7000 Seqeunce Detection system (Applied Biosystems)
Note: The reaction mix also contained 4microL of DNA and 2.5U of AmpErase UNG.
Forward(SG009001) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 17718-17742Tm: 73.9C at salt 1000.0 mMLength:
Sequence: CAGAACGCTGTAGCTTCAAAAATCT
(2 other experimental conditions)
Note:
Reverse(SG009002) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 17785-17761Tm: 75.5C at salt 1000.0 mMLength:
Sequence: TCAGAACCCTGTGATGAATCAACAG
(2 other experimental conditions)
Note:
Reverse(SG009003) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 17760-17745Tm: 50CLength:
Sequence: TCTGCGTAGGCAATCC
(2 other experimental conditions)
Note: This probe has a 6-carboxyfluorescein on the 5' end and a nonfluorescent quencher on the 3' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.