A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0086Publication date: 2004
PMID: 15135737GI: 33578015 Taxonomy ID: 227859
Virus Name: SARS coronavirus FRAProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):50C 120sec>60C 1800sec>95C 300sec>(94C 15sec>58C 60sec)*50
Buffer: 1x TaqMan EZ buffer
Polymerase: 2.5U rTth poly (Applied Biosystems)Cycler: 7000 Sequence Detection System (Applied Biosystems)
Note: The reaction mix also contained 3mM of manganese acetate, 2.5U AmpErase UNG, and 1200microM of dUTP instead of 300microM.
Forward(SG008601) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 17718-17742Tm: 73.9C at salt 1000.0 mMLength:
Sequence: CAGAACGCTGTAGCTTCAAAAATCT
(2 other experimental conditions)
Note: Located on the ORF1b region of the SARS-CoV genome.
Reverse(SG008602) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 17785-17761Tm: 75.5C at salt 1000.0 mMLength:
Sequence: TCAGAACCCTGTGATGAATCAACAG
(2 other experimental conditions)
Note: Located on the ORF1b region of the SARS-CoV genome.
Reverse(SG008603) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 17760-17745Tm: 50CLength:
Sequence: TCTGCGTAGGCAATCC
(2 other experimental conditions)
Note: Located on the ORF1b region of the SARS-CoV genome. The Probe has a 6-carboxyfluorescein on the 5' end and a nonfluorescent quencher on the 3' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.