A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0079Publication date: 05/04
PMID: 15147587GI: 24137221 Taxonomy ID: 10255
Virus Name: Variola virusProduct size (PCR): bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 300sec>(95C 30sec>55C 30sec>72C 60sec)*35>72C 420sec
Buffer: 10mM Tris-HCl (pH 9.0)
Polymerase: 1.5U Taq poly (Invitrogen)Cycler:
Note: The reaction mix also contained 50mM KCl, 0.1% Triton X-100, and 0.4microM of the single stranded DNA.
Forward(SG007901) primer
Oligo type: Forward PrimerDegeneracy: 4
Target: 520-539Tm: max Tm 72C min Tm 70C at salt 1000.0mMLength:
Sequence: GAC(G/T)TC(C/G)GGACCAATTACTA
(0 other experimental conditions)
Note:
Reverse(SG007902) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 620-598Tm: 66.1C at salt 1000.0 mMLength:
Sequence: TTGATTTAGTAGTGACAATTTCA
(0 other experimental conditions)
Note:
Forward(SG007903) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 546-570Tm: 73.9C at salt 1000.0 mMLength:
Sequence: AAGATCATACAGTCACAGACACTGT
(0 other experimental conditions)
Note: Used for hybridization in real time PCR assays.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.