A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0075Publication date: 03/04
PMID: 15109406GI: 37960831 Taxonomy ID: 258445
Virus Name: SARS coronavirus GD69Product size (PCR): 77 bp
MgCl2: mMdNTPs: mMType: Real-time RT-PCR
Temp (PCR cycle):
Buffer: 1X Buffer
Polymerase: 0.6microL Taq polyCycler:
Note: The reaction mix also contained 5microL RNA, 1microG Bovine serum albumin, and 3.6mM Magnesium Sulfate. Procedure taken from (Drosten et al. (2003) [PMID: 12690091]).
Forward(BNITMSARS1) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18188-18207Tm: 72C at salt 1000.0 mMLength:
Sequence: TTATCACCCGCGAAGAAGCT
(2 other experimental conditions)
Note:
Reverse(BNITMSARAS2) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18265-18244Tm: 76.6C at salt 1000.0 mMLength:
Sequence: CTCTAGTTGCATGACAGCCCTC
(2 other experimental conditions)
Note:
Forward(BNI-TMSARP) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 18218-18241Tm: 77C at salt 1000.0 mMLength:
Sequence: TCGTGCGTGGATTGGCTTTGATGT
(2 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.