A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0074Publication date: 03/04
PMID: 15109406GI: 30698326 Taxonomy ID: 258445
Virus Name: SARS coronavirus TW1Product size (PCR): 195 bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note: The reaction mix also included 2microL of RNA and 2.45mM Magnesium Sulfate. Procedure taken from (Drosten et al. (2003) [PMID: 12690091]).
Forward(BNIoutS) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18154-18177Tm: 70.2C at salt 1000.0 mMLength:
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:
Reverse(BNoutAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18343-18322Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CATAACCAGTCGGTACAGCTAC
(11 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.